Biotechnology: Principles and Processes — Notes

Biotechnology deals with techniques of using live organisms or enzymes from organisms to produce products and processes useful to humans. The European Federation of Biotechnology (EFB) defines it as “the integration of natural science and organisms, cells, parts thereof, and molecular analogues for products and services”.

Two core techniques: (i) genetic engineering — altering the chemistry of genetic material (DNA/RNA), introducing it into host organisms and thus changing their phenotype; (ii) bioprocess engineering — maintaining sterile (microbial-contamination-free) conditions to grow only the desired microbe or eukaryotic cell in large quantities to make antibiotics, vaccines, enzymes and other products.

Isolation of genomic DNA: cells are broken open with enzymes — lysozyme (bacteria), cellulase (plant cells), chitinase (fungi). RNA is removed with ribonuclease and proteins (such as histones) with protease. Addition of chilled ethanol precipitates purified DNA as a collection of fine threads in suspension, removed by spooling.

Gel electrophoresis: DNA fragments are separated in a matrix of agarose, a natural polymer extracted from sea weeds. DNA is negatively charged and moves towards the anode under an electric field. The gel acts as a sieve, so smaller fragments move farther. Separated DNA is stained with ethidium bromide and seen as bright orange bands under UV light. Bands are cut out and the DNA extracted (elution) for use in constructing recombinant DNA.

In 1963 two enzymes responsible for restricting the growth of bacteriophage in Escherichia coli were isolated: one added methyl groups to DNA, the other cut DNA (restriction endonuclease). The first restriction endonuclease whose action depended on a specific DNA sequence, Hind II, was isolated five years later; it always cuts DNA at a particular point by recognising a specific sequence of six base pairs (its recognition sequence). More than 900 restriction enzymes are now known from over 230 strains of bacteria.

Nomenclature: the first letter comes from the genus and the next two from the species of the prokaryote; the next letter is the strain, and the Roman numeral the order of isolation. EcoRI: Escherichia coli, strain RY 13, the first (I) enzyme.

Features: restriction enzymes belong to the nucleases. Exonucleases remove nucleotides from the ends of DNA; endonucleases cut at specific positions within it. Each restriction endonuclease recognises a specific palindromic nucleotide sequence — the sequence reads the same on the two strands when the orientation of reading is kept the same (5′→3′). They cut the strands a little away from the centre of the palindrome, between the same two bases on both strands, leaving single-stranded overhangs — sticky ends, which form hydrogen bonds with complementary cut counterparts. DNA ligase then joins the fragments. (Example: EcoRI cuts 5′–TTGAATTCCAGGCGAATTCTA–3′ into 3 fragments.)

Steps of recombinant DNA technology: isolation of DNA → fragmentation by restriction endonucleases → isolation of the desired DNA fragment → ligation into a vector → transfer of rDNA into a host → culturing host cells in a medium at large scale → extraction of the desired product.

Features required for cloning into a vector:

• Origin of replication (ori): the sequence from where replication starts; any DNA linked to it can replicate in the host. It also controls the copy number of the linked DNA.
• Selectable marker: helps identify and eliminate non-transformants and selectively permit growth of transformants — normally genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, tetracycline or kanamycin.
• Cloning sites: the vector should have very few, preferably single, recognition sites for commonly used restriction enzymes.
• Small size of the vector.

pBR322 is an E. coli cloning vector with ori, rop (codes for proteins participating in plasmid replication), ampᴿ and tetᴿ, and restriction sites for Hind III, EcoRI, BamHI, SalI, PvuII, PstI, ClaI and PvuI; BamHI and SalI lie within tetᴿ, PvuI and PstI within ampᴿ.

Vectors for plants and animals: Agrobacterium tumefaciens, a pathogen of dicots, delivers a piece of DNA (T-DNA) that transforms normal plant cells into a tumour; its Ti plasmid has been modified into a non-pathogenic cloning vector. Retroviruses in animals transform normal cells into cancerous ones; disarmed retroviruses are used to deliver desirable genes into animal cells. For very large DNA (genome projects), BAC (bacterial artificial chromosome) and YAC (yeast artificial chromosome) vectors are used.

Competent host: DNA is hydrophilic and cannot pass through cell membranes. Bacterial cells are made competent by treatment with a specific concentration of a divalent cation such as calcium. Recombinant DNA is incubated with the cells on ice, given a brief heat shock at 42 °C, and put back on ice, which enables the bacteria to take up the DNA.

Other methods: microinjection — recombinant DNA injected directly into the nucleus of an animal cell; biolistics (gene gun) — plant cells are bombarded with high-velocity micro-particles of gold or tungsten coated with DNA; disarmed pathogen vectors — Agrobacterium or retroviruses that transfer the recombinant DNA when they infect cells.

Selection of recombinants:

• Antibiotic resistance: when pBR322 carrying ampᴿ is introduced, only transformants grow on ampicillin medium.
• Insertional inactivation of an antibiotic-resistance gene: foreign DNA ligated at the BamHI site of tetᴿ destroys tetracycline resistance. Recombinants grow on ampicillin but not on tetracycline; non-recombinants grow on both. This needs simultaneous plating on two media.
• Blue-white selection: the foreign DNA is inserted within the coding sequence of β-galactosidase (lacZ), inactivating it (insertional inactivation). On a medium with a chromogenic substrate, colonies without an insert make blue colonies; recombinant colonies remain white.

Polymerase chain reaction (PCR) — amplification in vitro. Multiple copies of the gene of interest are synthesised using two sets of primers (small chemically synthesised oligonucleotides complementary to the ends of the target region) and DNA polymerase. Each cycle has three steps:

1. Denaturation — high temperature separates the two strands.
2. Annealing — primers bind to the complementary regions.
3. Extension — the enzyme extends the primers using the nucleotides provided. The thermostable DNA polymerase isolated from the bacterium Thermus aquaticus (Taq polymerase) remains active during the high-temperature denaturation. Repeating the cycle many times (for example 30) amplifies the DNA about a billion times: copies after n cycles = starting copies × 2ⁿ.

Amplification in vivo: the recombinant vector is introduced into a host where it replicates with the help of the ori, and multiplies as the host divides; high-copy-number plasmids give many copies per cell. If the gene is expressed in a suitable host, the recombinant protein is produced as well.

To produce large quantities of products, cells are grown in bioreactors, where large volumes (100–1000 litres) of culture can be processed. A bioreactor provides optimal conditions — temperature, pH, substrate, salts, vitamins and oxygen.

Stirred-tank bioreactors are usually cylindrical or have a curved base to help mixing. The stirrer facilitates even mixing and oxygen availability throughout. Sparged-tank bioreactors bubble sterile air through the medium, which increases the area for oxygen transfer. A bioreactor has an agitator system, an oxygen-delivery system, a foam-control system, a temperature-control system, a pH-control system and sampling ports.

Downstream processing: after the biosynthetic stage, the product undergoes separation and purification, then is formulated with suitable preservatives. Drugs undergo thorough clinical trials, and strict quality-control testing is required for each product.